• Background: FLT3 (FMS-like tyrosine kinase 3) belongs to the class III receptor tyrosine kinase (RTK) family. As a type I transmembrane protein, FLT3 is expressed on various lymphohematopoietic cells and tissues, including a range of immature cell lineages and lymphocytic leukemias. Flt3 gene knockout mice are viable and fertile; however, homozygous knockout leads to defects in B lymphocytes and impairs the long-term in vivo regenerative capacity of myeloid and lymphoid progenitors. Mutations in the FLT3 gene represent one of the most common genetic abnormalities in acute myeloid leukemia (AML), primarily comprising internal tandem duplication (ITD) mutations and point mutations in the tyrosine kinase domain, accounting for approximately 25% and 5% of cases, respectively. Both types of mutations can activate FLT3 receptor signaling, thereby promoting the proliferation and differentiation of AML cells.
• Targeting strategy: The endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT) in the exons 14 of mouse Flt gene were replaced by human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC).
• Validation: Immunophenotyping data revealed a developmental defect in B lymphocytes in the B-Flt3-ITD mice but not in C57BL/6JNifdc mice.
• Application: The efficacy evalsuation of leukemia-related drugs.

Gene targeting strategy for B-Flt3-ITD mice. The endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT) in the exons 14 of mouse Flt gene were replaced by human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC).

The spleens of B-Flt3-ITD mice (mut/+, female, 9-week-old, n=3) demonstrated a marked enlargement compared with those of C57BL/6JNifdc mice (+/+, female, 9-week-old, n=3).

Frequency of leukocyte subpopulations in spleen by flow cytometry. Splenocytes were isolated from wild-type C57BL/6JNifdc mice (+/+, female, 9-week-old, n=3) and B-Flt3-ITD mice (mut/+, female, n=3, 9-week-old). A. Flow cytometry analysis of the splenocytes was performed to assess the frequency of leukocyte subpopulations. B. Frequency of T cell subpopulations. The result indicated that B cells exhibit developmental defects in B-Flt3-ITD mice. The same phenotype was also observed in the peripheral blood, bone marrow, and lymph nodes in B-Flt3-ITD mice(data not shown). Values are expressed as mean ± SEM. Significance was determined by two-way ANOVA test.